Naomi Thomson Email & Phone Number
@qiagen.com
6 phones found area 267, 650, and 240
LinkedIn matched
Who is Naomi Thomson? Overview
A concise factual answer block for searchers comparing this professional profile.
Naomi Thomson is listed as ctcatttttgagatttcttgtcacgctaatggtgag translates to Life is Change. at Compass Bioinformatics, based in Fort Myers, Florida, United States. AeroLeads shows a work email signal at qiagen.com, phone signal with area code 267, 650, 240, and a matched LinkedIn profile for Naomi Thomson.
Naomi Thomson previously worked as Vice President Revenue and Product Innovation at Compass Bioinformatics and Graduate Student at University Of Florida College Of Pharmacy. Naomi Thomson holds Master Of Business Administration (Mba), Information Technology from La Salle University.
Email format at Compass Bioinformatics
This section adds company-level context without repeating Naomi Thomson's masked contact details.
AeroLeads found 1 current-domain work email signal for Naomi Thomson. Compare company email patterns before reaching out.
About Naomi Thomson
I leverage my breadth of technical experience and enthusiasm to nurture success at start-up and global organizations. I am an expert in strategic account management, product management, and team leadership with a strong background in Next Generation Sequencing, multi-omics, bioinformatics, and clinical diagnostics. My mission is to bridge the gaps between diagnostic, pharmaceutical, and research sectors in order to foster access to precision medicine.
Listed skills include Genomics, Bioinformatics, Sequencing, Dna Sequencing, and 38 others.
Naomi Thomson's current company
Company context helps verify the profile and gives searchers a useful next step.
Naomi Thomson work experience
A career timeline built from the work history available for this profile.
Graduate Student
CurrentGraduate program in Precision Medicine with a concentration in multi-omic technology for therapeutic development.
Ambassador
JADBIO, automates the use of state-of-the-art algorithms in Machine Learning, with initial applications inspired by data analysis problems in biomedicine. We manage the challenges of over-estimating and overfitting even with the complex data and limited sample sizes associated with multi-omics data.
Vice President Clinical Genomics
BRIDGenomics is a group of industry professionals dedicated to making a difference in healthcare through genomics. We help bridge the gap between diagnostic, pharmaceutical, and research sectors in the field of genomics. I am proud to be part of our dynamic team, with vast experience in genomics and a track record of not only meeting, but exceeding our.
Clinical Business Development Us And Senior Director Se Region Sales
This is an exciting dual role in which I mesh with two teams. I strengthen and build our clinical network in collaboration with our Managing Director. I also connect organizations who develop cancer directed therapeutics and diagnostics with Indivumed products and services
Senior Director Business Development
Indivumed's IndivuType platform, addresses the most critical challenges in cancer data analysis: confidence! The unique quality of the IndivuType platform starts in the surgery suite, with strong clinical partners and SOPs that limit ischemia time and guarantee the most complete set of multi-omics data possible: whole genome, whole transcriptome, miRNA.
Senior Director, Americas And Asia Pacific
Director, Business Development North America
Working with Bluebee colleagues in North America and in our headquarters in Europe to introduce Bluebee's unique private cloud-based accelerated genomics analysis platform. We enable secure, fast, scalable, efficient and affordable processing of Next Generation Sequencing data for our customer partners and for individual organizations.
Director, Clinical Analytics, Strategic Accounts And Southeast.
Responsible for introducing strategic clinical labs to QIAGEN's unique bioinformatics offerings in support of next generation sequencing analysis, interpretation, and reporting.
Director, Clinical Analytics Product Management
Collaborate across business areas to deliver key bioinformatics product in support of global NGS initiatives.
Next Generation Sequencing Key Account Manager
In 2008, as NGS became the dominant method of generating sequence data, CLC Bio introduced the Genomics Workbench, a revolutionary tool that enabled biologists to analyze their sequencing data on standard compute resources leveraging strong visualizations and a friendly user interface. CLC bio quickly became the leading bioinformatics solution provider.
Global Manager, Customer Care & Training
Global responsibility for support of prospective and existing customer base. Built customer happiness through on site training, tutorials, and trouble shooting. Provided all technical sales activities, including specification for custom development.
Manager
Creation of nucleic acid based core facilities, including, synthesis of standard and special oligonucleotides, Sanger-based automated sequencing, and management of core facility personnel. Also developed SOPs for the handling and storage of reagents for clinical use.
Research Scientist, Oncology
Directed DNA synthesis and DNA sequencing core facilities in Oncology
Research Associate
Nucleic Acid Synthesis
Naomi Thomson education
Master Of Business Administration (Mba), Information Technology
Bachelor Of Science (Bsc), Biology, General
Education record
Frequently asked questions about Naomi Thomson
Quick answers generated from the profile data available on this page.
What company does Naomi Thomson work for?
Naomi Thomson works for Compass Bioinformatics.
What is Naomi Thomson's role at Compass Bioinformatics?
Naomi Thomson is listed as ctcatttttgagatttcttgtcacgctaatggtgag translates to Life is Change. at Compass Bioinformatics.
What is Naomi Thomson's email address?
AeroLeads has found 1 work email signal at @qiagen.com for Naomi Thomson at Compass Bioinformatics.
What is Naomi Thomson's phone number?
AeroLeads has found 6 phone signal(s) with area code 267, 650, 240 for Naomi Thomson at Compass Bioinformatics.
Where is Naomi Thomson based?
Naomi Thomson is based in Fort Myers, Florida, United States while working with Compass Bioinformatics.
What companies has Naomi Thomson worked for?
Naomi Thomson has worked for Compass Bioinformatics, University Of Florida College Of Pharmacy, Jadbio, Bridgenomics, and Indivumed Group.
How can I contact Naomi Thomson?
You can use AeroLeads to view verified contact signals for Naomi Thomson at Compass Bioinformatics, including work email, phone, and LinkedIn data when available.
What schools did Naomi Thomson attend?
Naomi Thomson holds Master Of Business Administration (Mba), Information Technology from La Salle University.
What skills is Naomi Thomson known for?
Naomi Thomson is listed with skills including Genomics, Bioinformatics, Sequencing, Dna Sequencing, Molecular Biology, Biotechnology, Genetics, and Life Sciences.
Search by job title, company, industry, location, and seniority. Export verified B2B contact data when you need it.
Start free trial