Naomi Thomson

Naomi Thomson Email and Phone Number

ctcatttttgagatttcttgtcacgctaatggtgag translates to Life is Change. @ Compass Bioinformatics
Naomi Thomson's Location
Fort Myers, Florida, United States, United States
About Naomi Thomson

I leverage my breadth of technical experience and enthusiasm to nurture success at start-up and global organizations. I am an expert in strategic account management, product management, and team leadership with a strong background in Next Generation Sequencing, multi-omics, bioinformatics, and clinical diagnostics. My mission is to bridge the gaps between diagnostic, pharmaceutical, and research sectors in order to foster access to precision medicine.

Naomi Thomson's Current Company Details
Compass Bioinformatics

Compass Bioinformatics

View
ctcatttttgagatttcttgtcacgctaatggtgag translates to Life is Change.
Naomi Thomson Work Experience Details
  • Compass Bioinformatics
    Vice President Revenue And Product Innovation
    Compass Bioinformatics Nov 2024 - Present
  • University Of Florida College Of Pharmacy
    Graduate Student
    University Of Florida College Of Pharmacy Aug 2024 - Present
    Graduate program in Precision Medicine with a concentration in multi-omic technology for therapeutic development.
  • Jadbio
    Ambassador
    Jadbio Nov 2019 - Sep 2024
    Los Angeles, California, Us
    JADBIO, automates the use of state-of-the-art algorithms in Machine Learning, with initial applications inspired by data analysis problems in biomedicine. We manage the challenges of over-estimating and overfitting even with the complex data and limited sample sizes associated with multi-omics data.
  • Bridgenomics
    Vice President Clinical Genomics
    Bridgenomics Aug 2019 - Sep 2024
    BRIDGenomics is a group of industry professionals dedicated to making a difference in healthcare through genomics. We help bridge the gap between diagnostic, pharmaceutical, and research sectors in the field of genomics. I am proud to be part of our dynamic team, with vast experience in genomics and a track record of not only meeting, but exceeding our clients expectations.
  • Indivumed Group
    Clinical Business Development Us And Senior Director Se Region Sales
    Indivumed Group Feb 2023 - Oct 2023
    Hamburg, De
    This is an exciting dual role in which I mesh with two teams. I strengthen and build our clinical network in collaboration with our Managing Director. I also connect organizations who develop cancer directed therapeutics and diagnostics with Indivumed products and services
  • Indivumed Group
    Senior Director Business Development
    Indivumed Group Feb 2021 - Mar 2023
    Hamburg, De
    Indivumed's IndivuType platform, addresses the most critical challenges in cancer data analysis: confidence! The unique quality of the IndivuType platform starts in the surgery suite, with strong clinical partners and SOPs that limit ischemia time and guarantee the most complete set of multi-omics data possible: whole genome, whole transcriptome, miRNA, proteome, phospho-proteome from both cancer and normal adjacent tissue. We complement the deep molecular data with comprehensive and longitudinal clinical profiles. The quality control on all sides of the data instills the greatest confidence as our customer/partners validate drug targets and identify new biomarkers.
  • Bluebee
    Senior Director, Americas And Asia Pacific
    Bluebee Jan 2019 - Aug 2019
    Rijswijk, Nl
  • Bluebee
    Director, Business Development North America
    Bluebee Mar 2018 - Jan 2019
    Rijswijk, Nl
    Working with Bluebee colleagues in North America and in our headquarters in Europe to introduce Bluebee's unique private cloud-based accelerated genomics analysis platform. We enable secure, fast, scalable, efficient and affordable processing of Next Generation Sequencing data for our customer partners and for individual organizations.
  • Qiagen
    Director, Clinical Analytics, Strategic Accounts And Southeast.
    Qiagen Mar 2016 - Mar 2018
    Venlo, Limburg, Nl
    Responsible for introducing strategic clinical labs to QIAGEN's unique bioinformatics offerings in support of next generation sequencing analysis, interpretation, and reporting.
  • Qiagen
    Director, Clinical Analytics Product Management
    Qiagen Oct 2014 - Mar 2016
    Venlo, Limburg, Nl
    Collaborate across business areas to deliver key bioinformatics product in support of global NGS initiatives.
  • Clc Bio, A Qiagen Company
    Next Generation Sequencing Key Account Manager
    Clc Bio, A Qiagen Company Dec 2009 - Oct 2014
    In 2008, as NGS became the dominant method of generating sequence data, CLC Bio introduced the Genomics Workbench, a revolutionary tool that enabled biologists to analyze their sequencing data on standard compute resources leveraging strong visualizations and a friendly user interface. CLC bio quickly became the leading bioinformatics solution provider with a focus on Next Generation Sequencing. In addition to the desktop applications, CLC bio added enterprise solutions with options for command-line access for the advanced users impressed by the efficiency of the algorithms and workflows. CLC Bio's applications are comprehensive, cross-platform, and can analyze and visualize genomic, transcriptomic, and epigenomic data from all major Next Generation Sequencing platforms. I had the privilege of evangelizing the CLC bio NGS portfolio from the beginning until the acquisition by QIAGEN. Our enterprise customers included the largest pharmaceutical companies and the smallest universities. We provided great products with great service, and under the QIAGEN flag, CLC bio is still advancing the analysis of genomic data across the globe.
  • Gene Codes Corporation
    Global Manager, Customer Care & Training
    Gene Codes Corporation 2009 - Nov 2009
    Ann Arbor, Mi, Us
    Global responsibility for support of prospective and existing customer base. Built customer happiness through on site training, tutorials, and trouble shooting. Provided all technical sales activities, including specification for custom development.
  • Gene Codes Corporation
    Product Manager
    Gene Codes Corporation Mar 1999 - Dec 2008
    Ann Arbor, Mi, Us
    Translating customer needs into product specifications.
  • Kimeragen, Inc.
    Manager
    Kimeragen, Inc. Nov 1996 - Dec 1998
    Creation of nucleic acid based core facilities, including, synthesis of standard and special oligonucleotides, Sanger-based automated sequencing, and management of core facility personnel. Also developed SOPs for the handling and storage of reagents for clinical use.
  • Bristol-Myers Squibb
    Research Scientist, Oncology
    Bristol-Myers Squibb Dec 1988 - Nov 1996
    Lawrence Township, Nj, Us
    Directed DNA synthesis and DNA sequencing core facilities in Oncology
  • Wistar Institute
    Research Associate
    Wistar Institute 1986 - 1988
    Nucleic Acid Synthesis

Naomi Thomson Skills

Genomics Bioinformatics Sequencing Dna Sequencing Molecular Biology Biotechnology Genetics Life Sciences Biochemistry Lifesciences Dna Biopharmaceuticals Pcr Cell Biology Proteomics Sequence Analysis Commercialization Oncology Science Drug Discovery Immunology Product Management Qpcr Microbiology Cell Informatics Cell Culture Cancer Statistics R&d Software Development Hardware Diagnostics Pharmaceutical Industry Direct Sales Infectious Diseases Laboratory Automation Molecular Diagnostics Genotyping Leadership Business Development Strategy Cross Functional Team Leadership

Naomi Thomson Education Details

  • La Salle University
    La Salle University
    Information Technology
  • Bryn Mawr College
    Bryn Mawr College
    General
  • Bina Training
    Bina Training

Frequently Asked Questions about Naomi Thomson

What company does Naomi Thomson work for?

Naomi Thomson works for Compass Bioinformatics

What is Naomi Thomson's role at the current company?

Naomi Thomson's current role is ctcatttttgagatttcttgtcacgctaatggtgag translates to Life is Change..

What is Naomi Thomson's email address?

Naomi Thomson's email address is no****@****hoo.com

What is Naomi Thomson's direct phone number?

Naomi Thomson's direct phone number is +126724*****

What schools did Naomi Thomson attend?

Naomi Thomson attended La Salle University, Bryn Mawr College, Bina Training.

What skills is Naomi Thomson known for?

Naomi Thomson has skills like Genomics, Bioinformatics, Sequencing, Dna Sequencing, Molecular Biology, Biotechnology, Genetics, Life Sciences, Biochemistry, Lifesciences, Dna, Biopharmaceuticals.

Free Chrome Extension

Find emails, phones & company data instantly

Find verified emails from LinkedIn profiles
Get direct phone numbers & mobile contacts
Access company data & employee information
Works directly on LinkedIn - no copy/paste needed
Get Chrome Extension - Free

Aero Online

Your AI prospecting assistant

Download 750 million emails and 100 million phone numbers

Access emails and phone numbers of over 750 million business users. Instantly download verified profiles using 20+ filters, including location, job title, company, function, and industry.