Naomi Thomson Email and Phone Number
Naomi Thomson work email
- Valid
- Valid
- Valid
- Valid
- Valid
Naomi Thomson personal email
- Valid
- Valid
Naomi Thomson phone numbers
I leverage my breadth of technical experience and enthusiasm to nurture success at start-up and global organizations. I am an expert in strategic account management, product management, and team leadership with a strong background in Next Generation Sequencing, multi-omics, bioinformatics, and clinical diagnostics. My mission is to bridge the gaps between diagnostic, pharmaceutical, and research sectors in order to foster access to precision medicine.
-
Vice President Revenue And Product InnovationCompass Bioinformatics Nov 2024 - Present -
Graduate StudentUniversity Of Florida College Of Pharmacy Aug 2024 - PresentGraduate program in Precision Medicine with a concentration in multi-omic technology for therapeutic development. -
AmbassadorJadbio Nov 2019 - Sep 2024Los Angeles, California, UsJADBIO, automates the use of state-of-the-art algorithms in Machine Learning, with initial applications inspired by data analysis problems in biomedicine. We manage the challenges of over-estimating and overfitting even with the complex data and limited sample sizes associated with multi-omics data. -
Vice President Clinical GenomicsBridgenomics Aug 2019 - Sep 2024BRIDGenomics is a group of industry professionals dedicated to making a difference in healthcare through genomics. We help bridge the gap between diagnostic, pharmaceutical, and research sectors in the field of genomics. I am proud to be part of our dynamic team, with vast experience in genomics and a track record of not only meeting, but exceeding our clients expectations. -
Clinical Business Development Us And Senior Director Se Region SalesIndivumed Group Feb 2023 - Oct 2023Hamburg, DeThis is an exciting dual role in which I mesh with two teams. I strengthen and build our clinical network in collaboration with our Managing Director. I also connect organizations who develop cancer directed therapeutics and diagnostics with Indivumed products and services -
Senior Director Business DevelopmentIndivumed Group Feb 2021 - Mar 2023Hamburg, DeIndivumed's IndivuType platform, addresses the most critical challenges in cancer data analysis: confidence! The unique quality of the IndivuType platform starts in the surgery suite, with strong clinical partners and SOPs that limit ischemia time and guarantee the most complete set of multi-omics data possible: whole genome, whole transcriptome, miRNA, proteome, phospho-proteome from both cancer and normal adjacent tissue. We complement the deep molecular data with comprehensive and longitudinal clinical profiles. The quality control on all sides of the data instills the greatest confidence as our customer/partners validate drug targets and identify new biomarkers. -
Senior Director, Americas And Asia PacificBluebee Jan 2019 - Aug 2019Rijswijk, Nl -
Director, Business Development North AmericaBluebee Mar 2018 - Jan 2019Rijswijk, NlWorking with Bluebee colleagues in North America and in our headquarters in Europe to introduce Bluebee's unique private cloud-based accelerated genomics analysis platform. We enable secure, fast, scalable, efficient and affordable processing of Next Generation Sequencing data for our customer partners and for individual organizations. -
Director, Clinical Analytics, Strategic Accounts And Southeast.Qiagen Mar 2016 - Mar 2018Venlo, Limburg, NlResponsible for introducing strategic clinical labs to QIAGEN's unique bioinformatics offerings in support of next generation sequencing analysis, interpretation, and reporting. -
Director, Clinical Analytics Product ManagementQiagen Oct 2014 - Mar 2016Venlo, Limburg, NlCollaborate across business areas to deliver key bioinformatics product in support of global NGS initiatives. -
Next Generation Sequencing Key Account ManagerClc Bio, A Qiagen Company Dec 2009 - Oct 2014In 2008, as NGS became the dominant method of generating sequence data, CLC Bio introduced the Genomics Workbench, a revolutionary tool that enabled biologists to analyze their sequencing data on standard compute resources leveraging strong visualizations and a friendly user interface. CLC bio quickly became the leading bioinformatics solution provider with a focus on Next Generation Sequencing. In addition to the desktop applications, CLC bio added enterprise solutions with options for command-line access for the advanced users impressed by the efficiency of the algorithms and workflows. CLC Bio's applications are comprehensive, cross-platform, and can analyze and visualize genomic, transcriptomic, and epigenomic data from all major Next Generation Sequencing platforms. I had the privilege of evangelizing the CLC bio NGS portfolio from the beginning until the acquisition by QIAGEN. Our enterprise customers included the largest pharmaceutical companies and the smallest universities. We provided great products with great service, and under the QIAGEN flag, CLC bio is still advancing the analysis of genomic data across the globe.
-
Global Manager, Customer Care & TrainingGene Codes Corporation 2009 - Nov 2009Ann Arbor, Mi, UsGlobal responsibility for support of prospective and existing customer base. Built customer happiness through on site training, tutorials, and trouble shooting. Provided all technical sales activities, including specification for custom development. -
Product ManagerGene Codes Corporation Mar 1999 - Dec 2008Ann Arbor, Mi, UsTranslating customer needs into product specifications. -
ManagerKimeragen, Inc. Nov 1996 - Dec 1998Creation of nucleic acid based core facilities, including, synthesis of standard and special oligonucleotides, Sanger-based automated sequencing, and management of core facility personnel. Also developed SOPs for the handling and storage of reagents for clinical use.
-
Research Scientist, OncologyBristol-Myers Squibb Dec 1988 - Nov 1996Lawrence Township, Nj, UsDirected DNA synthesis and DNA sequencing core facilities in Oncology -
Research AssociateWistar Institute 1986 - 1988Nucleic Acid Synthesis
Naomi Thomson Skills
Naomi Thomson Education Details
-
La Salle UniversityInformation Technology -
Bryn Mawr CollegeGeneral -
Bina Training
Frequently Asked Questions about Naomi Thomson
What company does Naomi Thomson work for?
Naomi Thomson works for Compass Bioinformatics
What is Naomi Thomson's role at the current company?
Naomi Thomson's current role is ctcatttttgagatttcttgtcacgctaatggtgag translates to Life is Change..
What is Naomi Thomson's email address?
Naomi Thomson's email address is no****@****hoo.com
What is Naomi Thomson's direct phone number?
Naomi Thomson's direct phone number is +126724*****
What schools did Naomi Thomson attend?
Naomi Thomson attended La Salle University, Bryn Mawr College, Bina Training.
What skills is Naomi Thomson known for?
Naomi Thomson has skills like Genomics, Bioinformatics, Sequencing, Dna Sequencing, Molecular Biology, Biotechnology, Genetics, Life Sciences, Biochemistry, Lifesciences, Dna, Biopharmaceuticals.
Free Chrome Extension
Find emails, phones & company data instantly
Aero Online
Your AI prospecting assistant
Select data to include:
0 records × $0.02 per record
Download 750 million emails and 100 million phone numbers
Access emails and phone numbers of over 750 million business users. Instantly download verified profiles using 20+ filters, including location, job title, company, function, and industry.
Start your free trial