Naomi Thomson
AeroLeads people directory · profile

Naomi Thomson Email & Phone Number

ctcatttttgagatttcttgtcacgctaatggtgag translates to Life is Change. at Compass Bioinformatics
Location: Fort Myers, Florida, United States 16 work roles 3 schools
1 work email found @qiagen.com 6 phones found area 267, 650, and 240 LinkedIn matched
✓ Verified Jul 2026 4 data sources Profile completeness 100%

Contact Signals · 1 work email · 6 phones

Work email n****@qiagen.com
Direct phone (267) ***-****
LinkedIn Profile matched
3 free lookups remaining · No credit card
Current company
Role
ctcatttttgagatttcttgtcacgctaatggtgag translates to Life is Change.
Location
Fort Myers, Florida, United States

Who is Naomi Thomson? Overview

A concise factual answer block for searchers comparing this professional profile.

Quick answer

Naomi Thomson is listed as ctcatttttgagatttcttgtcacgctaatggtgag translates to Life is Change. at Compass Bioinformatics, based in Fort Myers, Florida, United States. AeroLeads shows a work email signal at qiagen.com, phone signal with area code 267, 650, 240, and a matched LinkedIn profile for Naomi Thomson.

Naomi Thomson previously worked as Vice President Revenue and Product Innovation at Compass Bioinformatics and Graduate Student at University Of Florida College Of Pharmacy. Naomi Thomson holds Master Of Business Administration (Mba), Information Technology from La Salle University.

Company email context

Email format at Compass Bioinformatics

This section adds company-level context without repeating Naomi Thomson's masked contact details.

{first}.{last}@qiagen.com
86% confidence

AeroLeads found 1 current-domain work email signal for Naomi Thomson. Compare company email patterns before reaching out.

Profile bio

About Naomi Thomson

I leverage my breadth of technical experience and enthusiasm to nurture success at start-up and global organizations. I am an expert in strategic account management, product management, and team leadership with a strong background in Next Generation Sequencing, multi-omics, bioinformatics, and clinical diagnostics. My mission is to bridge the gaps between diagnostic, pharmaceutical, and research sectors in order to foster access to precision medicine.

Listed skills include Genomics, Bioinformatics, Sequencing, Dna Sequencing, and 38 others.

Current workplace

Naomi Thomson's current company

Company context helps verify the profile and gives searchers a useful next step.

Compass Bioinformatics
Compass Bioinformatics
ctcatttttgagatttcttgtcacgctaatggtgag translates to Life is Change.
AeroLeads page
16 roles · 41 years

Naomi Thomson work experience

A career timeline built from the work history available for this profile.

Ambassador

Los Angeles, California, Us

JADBIO, automates the use of state-of-the-art algorithms in Machine Learning, with initial applications inspired by data analysis problems in biomedicine. We manage the challenges of over-estimating and overfitting even with the complex data and limited sample sizes associated with multi-omics data.

Nov 2019 - Sep 2024

Vice President Clinical Genomics

BRIDGenomics is a group of industry professionals dedicated to making a difference in healthcare through genomics. We help bridge the gap between diagnostic, pharmaceutical, and research sectors in the field of genomics. I am proud to be part of our dynamic team, with vast experience in genomics and a track record of not only meeting, but exceeding our clients expectations.

Aug 2019 - Sep 2024

Clinical Business Development Us And Senior Director Se Region Sales

Hamburg, De

This is an exciting dual role in which I mesh with two teams. I strengthen and build our clinical network in collaboration with our Managing Director. I also connect organizations who develop cancer directed therapeutics and diagnostics with Indivumed products and services

Feb 2023 - Oct 2023

Senior Director Business Development

Hamburg, De

Indivumed's IndivuType platform, addresses the most critical challenges in cancer data analysis: confidence! The unique quality of the IndivuType platform starts in the surgery suite, with strong clinical partners and SOPs that limit ischemia time and guarantee the most complete set of multi-omics data possible: whole genome, whole transcriptome, miRNA, proteome, phospho-proteome from both cancer and normal adjacent tissue. We complement the deep molecular data with comprehensive and longitudinal clinical profiles. The quality control on all sides of the data instills the greatest confidence as our customer/partners validate drug targets and identify new biomarkers.

Feb 2021 - Mar 2023

Senior Director, Americas And Asia Pacific

Rijswijk, Nl

Jan 2019 - Aug 2019

Director, Business Development North America

Rijswijk, Nl

Working with Bluebee colleagues in North America and in our headquarters in Europe to introduce Bluebee's unique private cloud-based accelerated genomics analysis platform. We enable secure, fast, scalable, efficient and affordable processing of Next Generation Sequencing data for our customer partners and for individual organizations.

Mar 2018 - Jan 2019

Director, Clinical Analytics, Strategic Accounts And Southeast.

Venlo, Limburg, Nl

Responsible for introducing strategic clinical labs to QIAGEN's unique bioinformatics offerings in support of next generation sequencing analysis, interpretation, and reporting.

Mar 2016 - Mar 2018

Director, Clinical Analytics Product Management

Venlo, Limburg, Nl

Collaborate across business areas to deliver key bioinformatics product in support of global NGS initiatives.

Oct 2014 - Mar 2016

Next Generation Sequencing Key Account Manager

Clc Bio, A Qiagen Company

In 2008, as NGS became the dominant method of generating sequence data, CLC Bio introduced the Genomics Workbench, a revolutionary tool that enabled biologists to analyze their sequencing data on standard compute resources leveraging strong visualizations and a friendly user interface. CLC bio quickly became the leading bioinformatics solution provider with a focus on Next Generation Sequencing. In addition to the desktop applications, CLC bio added enterprise solutions with options for command-line access for the advanced users impressed by the efficiency of the algorithms and workflows. CLC Bio's applications are comprehensive, cross-platform, and can analyze and visualize genomic, transcriptomic, and epigenomic data from all major Next Generation Sequencing platforms. I had the privilege of evangelizing the CLC bio NGS portfolio from the beginning until the acquisition by QIAGEN. Our enterprise customers included the largest pharmaceutical companies and the smallest universities. We provided great products with great service, and under the QIAGEN flag, CLC bio is still advancing the analysis of genomic data across the globe.

Dec 2009 - Oct 2014

Global Manager, Customer Care & Training

Ann Arbor, Mi, Us

Global responsibility for support of prospective and existing customer base. Built customer happiness through on site training, tutorials, and trouble shooting. Provided all technical sales activities, including specification for custom development.

2009 - Nov 2009

Product Manager

Ann Arbor, Mi, Us

Translating customer needs into product specifications.

Mar 1999 - Dec 2008

Manager

Kimeragen, Inc.

Creation of nucleic acid based core facilities, including, synthesis of standard and special oligonucleotides, Sanger-based automated sequencing, and management of core facility personnel. Also developed SOPs for the handling and storage of reagents for clinical use.

Nov 1996 - Dec 1998

Research Scientist, Oncology

Lawrence Township, Nj, Us

Directed DNA synthesis and DNA sequencing core facilities in Oncology

Dec 1988 - Nov 1996

Research Associate

Wistar Institute

Nucleic Acid Synthesis

1986 - 1988 ~2 yrs
3 education records

Naomi Thomson education

Master Of Business Administration (Mba), Information Technology

La Salle University

Bachelor Of Science (Bsc), Biology, General

Bryn Mawr College

Education record

Bina Training
FAQ

Frequently asked questions about Naomi Thomson

Quick answers generated from the profile data available on this page.

What company does Naomi Thomson work for?

Naomi Thomson works for Compass Bioinformatics.

What is Naomi Thomson's role at Compass Bioinformatics?

Naomi Thomson is listed as ctcatttttgagatttcttgtcacgctaatggtgag translates to Life is Change. at Compass Bioinformatics.

What is Naomi Thomson's email address?

AeroLeads has found 1 work email signal at @qiagen.com for Naomi Thomson at Compass Bioinformatics.

What is Naomi Thomson's phone number?

AeroLeads has found 6 phone signal(s) with area code 267, 650, 240 for Naomi Thomson at Compass Bioinformatics.

Where is Naomi Thomson based?

Naomi Thomson is based in Fort Myers, Florida, United States while working with Compass Bioinformatics.

What companies has Naomi Thomson worked for?

Naomi Thomson has worked for Compass Bioinformatics, University Of Florida College Of Pharmacy, Jadbio, Bridgenomics, and Indivumed Group.

How can I contact Naomi Thomson?

You can use AeroLeads to view verified contact signals for Naomi Thomson at Compass Bioinformatics, including work email, phone, and LinkedIn data when available.

What schools did Naomi Thomson attend?

Naomi Thomson holds Master Of Business Administration (Mba), Information Technology from La Salle University.

What skills is Naomi Thomson known for?

Naomi Thomson is listed with skills including Genomics, Bioinformatics, Sequencing, Dna Sequencing, Molecular Biology, Biotechnology, Genetics, and Life Sciences.

Find 750M verified contacts

Search by job title, company, industry, location, and seniority. Export verified B2B contact data when you need it.